EST: Expressed Sequence Tag

Teil einer copy DNA
(cDNA) - Nukleotidsequenz

Entwicklung einer cDNA aus einer mRNA mittels ReverseTranskriptase
(eigentlich keine Introns)

Expressionsanalyse durch cDNA

Extraktion von mRNA aus jeweiligen Zellen
Übung:
Einführung in die Bioinformatik
U. Scholz & M. Lange
Übung 1: ESTs # 1
EST-Entwicklung I
3‘
ATCCAATCGCCAATGCGCATCGGCCTCCCGAAAAAAA
Zelle
5‘
Einführung in die Bioinformatik
DNA
Transkription
UAGGGCGGUUACGCCCGGAGGGCTTTTTTT
Übung:
5‘
3‘
U. Scholz & M. Lange
mRNA
Übung 1: ESTs # 2
EST-Entwicklung II
mRNA
Zelle
Extraktion der mRNA
Reverse-Transkription
Glasschale
cDNA
Übung:
Einführung in die Bioinformatik
Nukleotide
Flüssigkeit + Enzym
U. Scholz & M. Lange
Übung 1: ESTs # 3
EST-Entwicklung III
3‘
5‘
DNA
Transkription
5‘UAGGGCGGUUACGCCCGGAGGGCUUUUU
U
3‘
mRNA
3‘
5‘
cDNA
ATCCAATCGCCAATGCGCATCGGCCTCCCGAAAAAAA
Reverse-Transkriptase
ATCCCGCCAATGCGGGCCTCCCGAAAAAAA
Bakterie
Chromosom
DNA
Übung:
Plasmide
Einführung in die Bioinformatik
Plasmid-Nukleotidsequenz
U. Scholz & M. Lange
Übung 1: ESTs # 4
EST-Entwicklung IV
rekombiniertes
DNAMolekül
DNAFragment
Vektor
Einschleusen in
Wirtszelle
Vermehrung des
rekombinierten
DNA-Moleküls
Bakterium
Vermehrung der
Wirtszelle
weitere
Zellteilungen
Teilung 3 mal pro Stunde
-> 12-16 h 108 bis 1010
Bakterien
Bakterienkolonien wachsen auf festem Nährboden
Übung:
Einführung in die Bioinformatik
U. Scholz & M. Lange
Übung 1: ESTs # 5
EST-Entwicklung V
Typisches eukaryotisches Gen mit Exon (E) / Intron (I) Struktur
E1
E2
I1
E3
I2
E4
E5
I3
I4
mRNAIsolation
mRNA
Reverse
Transkription
5'-UTR
3'-UTR
cDNA
5'-EST
3'-EST
Klonierung
cDNABibliothek
Sequenzierung
ESTSequenzen
Übung:
Einführung in die Bioinformatik
U. Scholz & M. Lange
Übung 1: ESTs # 6
EST-Entwicklung
VI
Vector
cDNA
Glasschale
Nukleotide
normale und pigmentierte
Übung:
Einführung in die Bioinformatik
Flüssigkeit + Enzym
U. Scholz & M. Lange
Übung 1: ESTs # 7
EST-Entwicklung VII
ATCCCGCCAAT
ATCCCGCCAATGCGGG
ATCCCGCCAATGCGGGCCT
ATCCCGC
ATCCCGCCAA
Übung:
Einführung in die Bioinformatik
ESTs
U. Scholz & M. Lange
Übung 1: ESTs # 8

uebung_1.ESTs