Biotechnologisches Gymnasium
BTG
Albert-Schweitzer-Schule, Villingen
Biotechnologisches Gymnasium
BTG
Das Fach Bioinformatik
Bioinformatik
ACATGAAGCAGATGAGGGATGAGCAGATTAG
MLTPRSAVHGPKRLEAASGETTAPKLMGAASVL
ACATGAAGCAGATGAGGGATGAGCAGATTAG
MLTPRSAVHGPKRLEAASGETTAPKLMGAASVL
ACATGAAGCAGATGAGGGATGAGCAGATTAG
MLTPRSAVHGPKRLEAASGETTAPKLMGAASVL
ACATGAAGCAGATGAGGGATGAGCAGATTAG
MLTPRSAVHGPKRLEAASGETTAPKLMGAASVL
ACATGAAGCAGATGAGGGATGAGCAGATTAG
MLTPRSAVHGPKRLEAASGETTAPKLMGAASVL
ACATGAAGCAGATGAGGGATGAGCAGATTAG
MLTPRSAVHGPKRLEAASGETTAPKLMGAASVL
ACATGAAGCAGATGAGGGATGAGCAGATTAG
MstII
MstII*
MstII
MLTPRSAVHGPKRLEAASGETTAPKLMGAASVL
MstII
ACATGAAGCAGATGAGGGATGAGCAGATTAG
MLTPRSAVHGPKRLEAASGETTAPKLMGAASVL
Biotechnologisches Gymnasium
Die Bioinformatik ist eine neue Disziplin an der Schnittstelle
zweier Wissenschaftsgebiete:
der molekularen Biologie (Bio-) und der Informatik (- informatik).
Die Bioinformatik wendet neueste Informationstechnologie
zur Bearbeitung biologischer Daten an. Sie beschäftigt sich mit
der Analyse der Erbinformation (DNA), in dem sie die DNA und
die aus ihr abgeleiteten Eiweisse (Proteine) analysiert.
Im Fach Bioinformatik werden biotechnologische und
informationstechnische Unterrichtsinhalte vernetzt. Unterrichtsinhalte sind u.a. die Modellierung zellulärer Systeme und die
Analyse informationstragender Biomoleküle mit Hilfe des Computers.
atgcgtgtga
Der genetische Code
atg-gtgtga
atgcgtgtga
atccgt-tga
Die Code-Sonne
atgcgtgtga
atgcgtgtga
Codogen
DNA
Codon
mRNA
Anticodon
tRNA
Aminosäure
Protein
at-cgtgtga
atgcgtgtga
atgcgtgt-a
atgcgtgtga
atgcgtgtgt
atg-gtgtga
atgcgtgtgt
atgcgtgt-a
atgcgtgtga
atg-gtgtga
atgcctgtgt
atgcacgtga
atg-gt-tga
atgcgtcagt
atg-gtgtga
Quelle: Wikipedia
Der genetische Code verknüpft die Basensequenz der DNA über die
mRNA-Transkripte mit der Aminosäuresequenz der Proteine.
atgcgtgtga
atg-gtgtga
atgcgtgtga
atccgt-tga
atgcgtgtga
atgcgtgtga
at-cgtgtga
atgcgtgtga
atgcgtgt-a
atgcgtgtga
atgcgtgtgt
atg-gtgtga
atgcgtgtgt
atgcgtgt-a
atgcgtgtga
atg-gtgtga
atgcctgtgt
atgcacgtga
atg-gt-tga
atgcgtcagt
atg-gtgtga
Die Struktur der Information tragenden Moleküle
DNA, RNA und Protein
atgcgtgtga
atg-gtgtga
atgcgtgtga
Das Virus Phi-X174
atccgt-tga
atgcgtgtga
atgcgtgtga
at-cgtgtga
atgcgtgtga
atgcgtgt-a
atgcgtgtga
atgcgtgtgt
atg-gtgtga
atgcgtgtgt
atgcgtgt-a
atgcgtgtga
atg-gtgtga
atgcctgtgt
atgcacgtga
atg-gt-tga
atgcgtcagt
atg-gtgtga
Übersichtsschema zur DNA-Basenverteilung
atgcgtgtga
Kann man den DNA-Code sichtbar machen ?
atg-gtgtga
atgcgtgtga
1.
atccgt-tga
atgcgtgtga
A
C
G
2.
T
_
atgcgtgtga
at-cgtgtga
atgcgtgtga
atgcgtgt-a
atgcgtgtga
atgcgtgtgt
atg-gtgtga
atgcgtgtgt
atgcgtgt-a
atgcgtgtga
atgcctgtgt
atgcacgtga
atg-gt-tga
atgcgtcagt
atg-gtgtga
+
Leserichtung
atg-gtgtga
3.
A
C
A
C
A
T
G
T
G
A
C
A
C
C
T
A
C
C
A
T
A
C
A
A
G
A
C
T
G
5‘ GTCAGAACATACCAT
CCACAGTGTACACA 3‘
Die Abfolge der DNABausteine A, C, G und T
kann im Labor analysiert
werden.
1.
Der Code wird als Abfolge
von DNA-Banden sichtbar
gemacht.
2.
Die Zeichenfolge (DNASequenz) kann abgelesen
werden.
3.
Die gesamte Sequenz eines
Gens wird so bestimmt.
atgcgtgtga
Wie viel genetischer Text steckt in der DNA ?
atg-gtgtga
atgcgtgtga
atccgt-tga
atgcgtgtga
atgcgtgtga
at-cgtgtga
atgcgtgtga
atgcgtgt-a
atgcgtgtga
atgcgtgtgt
atg-gtgtga
atgcgtgtgt
atgcgtgt-a
atgcgtgtga
atg-gtgtga
atgcctgtgt
atgcacgtga
atg-gt-tga
atgcgtcagt
atg-gtgtga
1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
3241
3301
gagttttatc
aaattatctt
tgctggcgga
gcgacctttc
tggcttaata
catggtagag
gctgttcaac
tccagaccgc
aagatgattt
ctcgtcgctg
ttcctgctcc
ttcaaacggc
tcgagcgtcc
acactgacgt
tgatgtaatg
gcgaggtact
ttaattgcag
cgccgagcgt
tcttattacc
tggcgctctc
ttttactttt
ggatggtgtt
cgcttttctt
ttatttgaat
taaccctaat
aaacatttgg
taccacatct
agaacgtgat
ctcttatgac
ctatgatgtt
gacctataaa
tgcgcttgtt
tgctttgact
tgaaatttct
tgagggtcag
aggcttccca
ccaccatgat
taaatttaat
gtgataaaag
gctgaggggt
cagactttta
gttactccag
tattttgata
gatacatctg
gccgacccta
ctcccgactg
gtcaaggact
ggtttcatgg
caggttatta
ctattgctgg
gcggtcaaaa
ctgtaggcat
ctgatgaggc
ttgaaggtac
gacttggtgg
catttcctga
gcttccatga
gataaagcag
aaatgagaaa
gccatcaact
tgcttggcac
attctcttgt
cactaatagg
tttggcctct
cgattttctg
cgttgaggct
tgttgagttt
ctgtctcatc
ggttaaagcc
tcttactgac
tctaaaggta
aaaggcaagc
gggcttcggc
atgccgcatg
atttcaacta
cgtctttctc
tatgtccctc
aatgccactc
ggcacgatta
atctataaca
gagcttaatc
actgctccgc
attgacatta
tacttcatgc
gctgacaacc
gatggaactg
cattctgtgc
cgttttccgc
tataccgata
atgaaggatg
tggtatcgtt
ttcattcagg
tatgaccagt
gtgaccgttt
attgagtgtg
tgaccaagcg
tttctcgcca
cttcttcggc
gtttgacggt
tcaacgccgc
aattttttgc
cctatgatgt
gtgtgactat
tttggtctaa
aagagattat
cggtattgct
agccgcctcc
gggtgatgct
cgcccctagt
gttgcaggct
caagtctgcc
gcttaatgct
cgcagaagtt
gaattactac
attcgaccta
aacgattctg
gttcgtcaag
tgacatttta
taagaaatca
attaagctca
acgagtaaca
tgcgtttatg
attgctgccg
atggaaggcg
gctgaattgt
gcagaagaaa
aaaaacgttc
gtaaaggcgc
cccttacttg
acctttccca
ctccggttat
cattgcgtcg
atcgtcacgt
ctctcccgac
accctgatac
actattttaa
aagatgatgc
ttcctcctga
tgggtctgca
agcgttacca
gtcctttact
accaaacgtc
cgcgtttctt
ctactgcgac
ttgctggcga
ttttccgttc
atgcgccttc
aaccgccttc
gtttccagtc
atcgcaatct
aggttataac
aagcgcggta
taattcaaac
acctgtttta
taatgctggt
taatcaggtt
ctgtttggtt
ttatcctttg
tgacgtcctt
ctttaccgct
ttgtctccag
tctgctcttg
ggtggcattc
ggtattaaat
tttgtttctg
ggcacttctg
gctgataaag
tgggagcgtg
aacactttcg
tgcttgttta
tccttgcgca
tcaaaaactg
gactggttta
aaagagcgtg
tgagtcaagt
ttcaggcttc
aagtttggat
gtacgctgga
tcattgctta
ctgaatttac
tcgcgtttac
acgtgcgtca
tggcgctcgc
tcgtctttgg
aggataaatt
tcttggcttc
cgctggcgac
tggccttgct
ttatggtgaa
tgttaacact
caataaaatc
agcgccgtgg
tcgttatggt
gactgagctt
agctgcttat
tgatgttatt
tgtcatgcgc
gttaggccag
tgttcctgag
taaagagatt
ccctgttttg
tggtgattcg
gtatgtttct
tggtgatttg
cgttcagttg
gccgaccact
gccgaagcgg
ggttttctgc
tttttttctg
cagacaccta
aatggtggtt
gtttctgttg
cgctttgagt
aatggtcgcc
ccccgtacgc
actaaatgcc
ccacttaagt
ctggtggcgc
aaggtgatgt
ctgccattca
gtgctatggc
ccgtttctga
gaaaggatac
ctggtgctga
gatatttctg
cgaattaaat
gctcgagaag
acgcgttgga
gatatgagtc
gattactatc
tactgaacaa
tgccgttttg
tgctactgac
ctttgtggga
ttatgttcat
ggaaaacatt
cttgcgtgta
aaaattacgt
cctggtcgtc
tatgtaggtg
atgtctaata
cttgctggtc
tccttcgaga
attgactcta
cagtggatta
actggttata
cctaagcatt
atgcctgacc
ttccgttgct
tctcgccaaa
gctaatttgc
tcttcatttg
tctaatctct
ttttctggtc
catggcacta
cagtacctta
tatggcaact
tctaagaagt
cctgcttatc
caagaacgcg
ttgcagtgga
cgcgattcaa
taaaaatttt
ttaggagttt
ataagctggt
aagctacatc
ttcttcattg
gtgctgatat
cttcttcggt
atgatggtgg
cgggcaataa
gcggattggt
gaggtgattt
catgtctaaa
gcttgctacc
aggctctaat
taaagctggt
taagttgctt
tcgtgattat
tgcttcctct
atgagtcgaa
cgaagtggac
ctcttacttt
tgaggagaag
acattttgtt
tgagtccgat
tccgtacgtt
gatttaaccg
cgctctcgtg
taccctcgct
cccgtcaaca
attaatggcg
cgcgcaggaa
gcggaaggag
cgcagccgtt
gtcaacaatt
ttcaaactgg
agattggtcg
tggacgccgt
ctgtagacat
agttcatgaa
ttgaccatgc
tgtttcaggg
gtaccgaggc
gccatctcaa
tgacgacttc
atactgacca
gaggtaaaac
gggcatctgg
gtgttcaaca
tgtttactct
acgctaaagg
tgccgccgcg
ttaagattgc
accttcttga
tacttattcg
atagtcaggt
tcatgacttc
aatttttgcc
aatcatgttt
tctcacttct
gtcaacgtta
cattcagatg
tgcttttgat
tccgactacc
ttattatacc
cgtttatgtt
ttcgctgaat
atgtttggtg
ttgtttggag
gataacaata
gttcctaacc
aaaggacttc
gatttggttg
cttgctgctg
gctggtatgg
Die gesamte Erbinformation
des Virus Phi-X174
5386 DNA-Buchstaben
3361
3421
3481
3541
3601
3661
3721
3781
3841
3901
3961
4021
4081
4141
4201
4261
4321
4381
4441
4501
4561
4621
4681
4741
4801
4861
4921
4981
5041
5101
5161
5221
5281
5341
ttgacgccgg
agattgccga
cacgccagaa
aggagtctac
aggtttccga
ccaatgacca
agcaaacgca
ctaatgtcgt
ctgttgccga
atttgtctag
caaatcttgg
attttgactt
ctctttctca
tggaagagat
ttgacggcca
taatggatga
tagaccaccg
agttttgccg
accccaaaaa
aatcgcgtag
atggttggtt
atgataatcc
ccgagggtcg
agtatggtac
ctacaggtag
gcttgcaaaa
acgctttttc
ctaccagtta
tggaccttgc
tgtcgctact
tgctcacaat
acgcgacgcc
tgggaaaagt
aatttatgcg
atttgagaat
gatgcaaaat
tacgaaagac
tgctcgcgtt
gattatgcgc
aatcaaagaa
gaatcagcgg
cactgatgct
tacttggaac
gaaataaccg
aggctttttt
tgagcgtatc
atccccaatg
tctgtctttt
taaggctgct
attggcacaa
ccccgaaggg
caagctggct
gaaaggtatt
aggctttgct
tatcgttttt
caatgctttg
caaggctaat
agctaatggc
cgttgaccct
tacgtggcct
acgttctggt
tatggctgtt
tgctaaaggt
tcccaagaag
gacaaatctg
gttcaaccag
tactgtagcc
cgcttcgata
caaaaagagc
gagactcaaa
caggtatatg
gcgtctatta
caaatgctta
atgactcgca
tatggctctt
gcttctggtg
aatttctgga
tcaggattga
atggttcgtt
gaggctctta
cttggcttcc
cgtatgcagg
tctgacgttc
tgctacaatg
gacgaaaaat
gctgaacgcc
aaggatgagt
attcagcgtt
gacactctca
cgtgactatt
gattcacacg
cgtcttcatt
aattttggtc
tatggttaca
tggttgtggc
ggtttctatg
ctaggagcta
ctgttcagaa
tccacggagt
atattgaagc
gacgttttgg
aaaatgattg
ttactaaaat
aagagattgc
cacaaaatga
tggaaaacac
ctcaagctca
aggttagtgc
ctcatattgg
tggttgatat
aagacggtaa
caccctccca
cttattaccc
aacctgctat
ataagcagat
gcgttgagtt
gtgatgagtt
tgctccccca
ggtttttaga
ctcttaagga
gttcaagatt
tgatgaatgc
cgttggctga
ttcgtgatat
ccgactgcta
tccatgcggt
gtcgggtacg
gtatgcccat
ctgttgatgc
tggctaaata
aagaatggaa
tcagaatgag
gcttaatcca
agaacgcaaa
cggcgcaacc
gcgtatccaa
gcaactggac
tggcattcag
gatgcttgct
caatctttcc
aacggctggt
tgaggttgac
cgctactgca
ttttcatggt
agctgatggt
attgtatgtt
ttctgaatgt
tgaggcttgt
ggataaccgc
cgataatggt
tgtatctgtt
acttgatatt
gaacgagaag
tattcgcgat
gctggaggcc
aatgcgacag
cgaccgatta
tggtcgtatg
tcagtatttt
gcactttatg
caatcgccgc
cgcagttcgc
taaaggtgag
cgttaacaaa
caactcacta
ccgcaacttc
acttaccaag
aagagagatg
tgtgacgaca
cctgca
aatcagaaag
tcggcgactt
tatcaacaga
aagcaacagc
cagtatttta
ttagttcatc
aaggatattt
attgataaag
attggctcta
ttcatgcctc
cacgctgatt
ggcatttcta
atcaagctct
gatatgtatg
actgagaagt
aataacacta
acggttacgc
gagtataatt
tccactatga
gctcatgctg
gaggcgtttt
gttcttgctg
tgtgtgcctg
cggacacttc
cagttaaata
tacacgcagg
ccgcttaaag
aagtcagata
aaaaccaagc
gggatgaaaa
ctgggttacg
agattgaggc
aatctgctca
atgcgtgtga
atg-gtgtga
Vergleich der Menge der Erbinformation
atgcgtgtga
atccgt-tga
atgcgtgtga
atgcgtgtga
at-cgtgtga
Die Erbinformation
des Virus Phi-X174
atgcgtgtga
atgcgtgt-a
5386 DNA-Buchstaben
atgcgtgtga
1 A4-Seite
atgcgtgtgt
atg-gtgtga
atgcgtgtgt
atgcgtgt-a
Die Erbinformation
des Menschen
atgcgtgtga
atg-gtgtga
atgcctgtgt
3 Milliarden DNA-Buchstaben
A4A4A4A4A4A4A4Seite
A4Seite
Seite
A4Seite
A4Seite
Seite
Seite
Seite
Seite
Seite
atgcacgtga
atg-gt-tga
atgcgtcagt
atg-gtgtga
556999 A4-Seiten
atgcgtgtga
atg-gtgtga
Nutzung von Gen-Datenbanken
atgcgtgtga
atccgt-tga
atgcgtgtga
Große Gen-Datenmengen aus verschiedenen Datenbanken stehen
zum Herunterladen und Vergleichen zur Verfügung.
atgcgtgtga
at-cgtgtga
atgcgtgtga
Sowohl einzelne Gene als auch die Gesamtheit der Gene eines
Organismus (Genom) können analysiert werden.
atgcgtgt-a
atgcgtgtga
atgcgtgtgt
atg-gtgtga
http://www.ncbi.nlm.nih.gov
atgcgtgtgt
atgcgtgt-a
http://www.ebi.ac.uk
atgcgtgtga
atg-gtgtga
atgcctgtgt
atgcacgtga
atg-gt-tga
atgcgtcagt
atg-gtgtga
http://www.rcsb.org
http://www.tigr.org
atgcgtgtga
Der Vergleich biologischer Information
atg-gtgtga
atgcgtgtga
atccgt-tga
Die Suche nach Ähnlichkeiten biologischer Information
atgcgtgtga
atgcgtgtga
at-cgtgtga
atgcgtgtga
atgcgtgt-a
„ Hohe Ähnlichkeit “
„ Sechs Gene “
atgcgtgtga
atgcgtgtgt
atg-gtgtga
Biologische
Information
Vergleichende
Analyse
Interpretation
atgcgtgtgt
atgcgtgt-a
Gen 1
atgcgtgtga
Gen 2
Gen 1 ähnelt Gen 2
atg-gtgtga
atgcctgtgt
atgcacgtga
atg-gt-tga
Genom A
atgcgtcagt
Genom B
atg-gtgtga
Genom 1 ähnelt Genom 2
atgcgtgtga
Bewertungen von Alignments
atg-gtgtga
atgcgtgtga
Bewertung eines N u k l e i n s ä u r e - Alignments
atccgt-tga
atgcgtgtga
Identitäten
atgcgtgtga
at-cgtgtga
atgcgtgtga
atgcgtgt-a
atgcgtgtga
atgcgtgtgt
Sequenz 1:
Sequenz 4:
TAGCTAGTTGAGATC
+++ +++ +++++++
TAG-TAGCTGAGATC
atg-gtgtga
atgcgtgtgt
Indel (Gap)
atgcgtgt-a
Nicht-Identität
atgcgtgtga
atg-gtgtga
atgcctgtgt
atgcacgtga
atg-gt-tga
atgcgtcagt
atg-gtgtga
Identitäten:
Nicht-Identitäten:
Indels (Gaps):
86,7 %
6,7 %
6,7 %
atgcgtgtga
Bewertungen von Alignments
atg-gtgtga
atgcgtgtga
Bewertung eines A m i n o s ä u r e - Alignments
atccgt-tga
atgcgtgtga
atgcgtgtga
at-cgtgtga
atgcgtgtga
Identitäten:
Positives:
Nicht-Identitäten:
Indels (Gaps):
80,0
6,7
6,7
6,7
%
%
%
%
atgcgtgt-a
atgcgtgtga
Konservativer Austausch (Positive)
atgcgtgtgt
atg-gtgtga
Identitäten
atgcgtgtgt
Identitäten
atgcgtgt-a
atgcgtgtga
atg-gtgtga
atgcctgtgt
atgcacgtga
Sequenz A:
Sequenz B:
MEINEASSEQVENTS
MEIN ASSE+VEN S
MEIN-ASSEKVENNS
atg-gt-tga
atgcgtcagt
atg-gtgtga
Indel (Gap)
Nicht-Identität
1
DNA-Mustererkennung
DNA 1
Wie kann man verschiedene DNA-Stränge unterscheiden ?
DNA 2
Darstellung des DNA-Doppelstrangs als Kalottenmodell
Wie kann man verschiedene DNA-Zeichenfolgen unterscheiden ?
DNA 1
z.B. durch Suche nach dem Restriktionsmuster GAATTC
5` ATGACAGATGACAGTAGACAGATGACAGATAGACAGATAGACAAGAGGGATTAGGACCACAGGATTAGAAAAAT
TAGACCAGATGACAGAATTCAGATGACAGATAGACAGAGACAGATGACAGATAGACAGATAGACAAGAGGGATTACC
TTTTTAACAGGTAGACAGATAGGACCAGGCGCGCGCGTATAGGACCATATATATTTGGGCAGATGACAGGAGATAGG
AACCAAAATTAGACATTATAGGCAGAGCGCGCAGATAGACATAGAACAGATGAGACAGGATAGACACCCACAGATAG
CCAGGACAGGATATTAGGACCAGGATTTTTTTAGGAGACCAAAAAACAGGATAGGACCAGTATTTTTAGGACAGGAT
CCAGATTAGGACCCAGATTTAGGAGCAGATAGGGACCAGGAGATATATAAAACATTGACAGGGGGAGAAGACAGAGG
GGAGATTAGGACCCAGATTTAGGAGCAGATAGGGACCAGGAGATATATAAAAAATTGACAGGGGGAGAAGACAGAGG
ATTTTAACAGGTAGACAGATAGGACCAGGCGCGCGCGTATAGGACCATATATATTTGGGCGAATTCCAGGAGATAGG
CCAGGACAGGATATTAGGACCAGGATTTAATTAGGAGACCAAAAAACAGGATAGGACCAGTATATTTAGGACAGGAT
AGCCAATATTAGACATTATAGGCAGAGCGCGCAGATAGACATAGAACAGATGAGACAGGATAGACACCCACAGA 3`
DNA 2
5` GATAGACATGACAGTAGACAGATGACAGATAGACAGATAGACAAGAGGGATTAGGACCACAGGATTAGAAGGAC
AAGACCAGATGACAGTAGACAGATGACAGATAGACAGAGACAGATGACAGATAGACAGATAGACAAGAGGGATTACC
AATTTAACAGGTAGACAGATAGGACCAGGCGCGCGCGTATAGGACCATATATATTTGGGCAGATGACAGGAGATAGG
TACCAAAATTAGACATTATAGGCAGAGCGCGCAGATAGACATAGAACAGATGAGACAGGATAGACACCCACAGATAG
GCAGGACAGGATATTAGGACCAGGATTAAATTAGGAGACCATAAAACAGGATAGGACCAGTATTATTAGGACAGGAT
CCAGATTAGGACCGAATTCTAGGAGCAGATAGGGACCAGGAGATATATAAAACATTGACAGGGGGAGAAGACAGAGG
CGAGATTAGGACCCAGATGTAGGAGCAGATAGGGACCAGGAGATATATAATAAATTGACAGGGGGAGAAGACAGAGG
TATTTAACAGGTAGACAGATAGGACCAGGCGCGCGCGTATAGGACCATATATATTTGGGCAGATGACAGGAGATAGG
GCAGGACAGGATATTAGGACCAGGATTTAATTAGGAGACCACATTACAGGATAGGACCAGTATATTTAGGACAGGAT
TGCCAATATTAGACATTATAGGCAGAGCGCGCAGATAGACATAGAACAGATGAGACAGGATAGACACCCATAAC 3`
2
DNA-Kartierung: Verschiedene b-Globin-DNAs im Vergleich
1
444
Bp
444
Bp
Homo sapiens
Mensch
1
376
Bp
Pan troglodytes
Schimpanse
1
354
Bp
Gorilla gorilla
Gorilla
1
Xenopus tropicalis
Krallenfrosch
Kann ein Vergleich der DNA-Sequenzen der b-Globine Aufschluss
über die Verwandtschaftverhältnisse der Arten geben ?
3
Multiples Alignment:
Vielfacher Sequenzvergleich zur Bestimmung des Pribnow-Konsensus
Excel-Tabellenblatt zur Ermittlung des Pribnow-Konsensus
Pribnow-Konsensus TATAAT
4
Bearbeitung und Auswertung biologischer Information
=> Anwendung spezieller Analyse-Software
5
Bearbeitung und Auswertung biologischer Information
=> Programmieren mit der Perl-Software
Ende

Bioinformatik - Albert-Schweitzer